dopamine d4 Search Results


dopamine d 4 receptor  (Alomone Labs)
90
Alomone Labs dopamine d 4 receptor
Dopamine D 4 Receptor, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/Anti-D4+Dopamine+Receptor+Antibody/pmc05420484-173-23-29
Average 90 stars, based on 1 article reviews
dopamine d 4 receptor - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
dopamine d4 hydrochloride  (Santa Cruz Biotechnology)
93
Santa Cruz Biotechnology dopamine d4 hydrochloride
Dopamine D4 Hydrochloride, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/Dopamine-d4+Hydrochloride/10__1007_slash_s00289___025___05874___5-46-0-6
Average 93 stars, based on 1 article reviews
dopamine d4 hydrochloride - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
shrna sequences targeting d4r gctgctcatcggcttggtgtt  (OriGene)
90
OriGene shrna sequences targeting d4r gctgctcatcggcttggtgtt
Shrna Sequences Targeting D4r Gctgctcatcggcttggtgtt, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/Dopamine+Receptor+D4+(DRD4)+Human+shRNA+Plasmid+Kit/us10668061-94-12-21
Average 90 stars, based on 1 article reviews
shrna sequences targeting d4r gctgctcatcggcttggtgtt - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
drd4 rabbit polyclonal antibody  (Proteintech)
94
Proteintech drd4 rabbit polyclonal antibody
Silencing <t>DRD4</t> significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).
Drd4 Rabbit Polyclonal Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/DRD4+Antibody/pmc12110546-97-28-33
Average 94 stars, based on 1 article reviews
drd4 rabbit polyclonal antibody - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
recombinant rat dopamine receptor 3  (OriGene)
90
OriGene recombinant rat dopamine receptor 3
Silencing <t>DRD4</t> significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).
Recombinant Rat Dopamine Receptor 3, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/Dopamine+Receptor+D4+(DRD4)+Rabbit+Polyclonal+Antibody/pmc07215910-48-58-74
Average 90 stars, based on 1 article reviews
recombinant rat dopamine receptor 3 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
dopamine receptor d4  (Aviva Systems)
92
Aviva Systems dopamine receptor d4
Silencing <t>DRD4</t> significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).
Dopamine Receptor D4, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/D4+Dopamine+Receptor+Peptide/10__1289_slash_ehp7349-132-15-35
Average 92 stars, based on 1 article reviews
dopamine receptor d4 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
dopamine d4 hcl  (Cerilliant Corporation)
90
Cerilliant Corporation dopamine d4 hcl
Silencing <t>DRD4</t> significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).
Dopamine D4 Hcl, supplied by Cerilliant Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/Dopamine-D4+Hydrochloride+(100%C2%B5g%2Fml)+(as+free+base)+in+Methanol/pm34302355-116-12-16
Average 90 stars, based on 1 article reviews
dopamine d4 hcl - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
d4-dopamine  (Cambridge Isotope Laboratories)
90
Cambridge Isotope Laboratories d4-dopamine
Silencing <t>DRD4</t> significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).
D4 Dopamine, supplied by Cambridge Isotope Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/dopamine+d4/pm32275862-291-17-4
Average 90 stars, based on 1 article reviews
d4-dopamine - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
deuterium-labeled dopamine 3 d4-da  (IsoSciences llc)
90
IsoSciences llc deuterium-labeled dopamine 3 d4-da
Silencing <t>DRD4</t> significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).
Deuterium Labeled Dopamine 3 D4 Da, supplied by IsoSciences llc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/deuterium+labeled+dopamine+3+d4+da/pm31233839-52-1-11
Average 90 stars, based on 1 article reviews
deuterium-labeled dopamine 3 d4-da - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
dopamine (da)- d 4  (Qmx Laboratories Ltd)
90
Qmx Laboratories Ltd dopamine (da)- d 4
Silencing <t>DRD4</t> significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).
Dopamine (Da) D 4, supplied by Qmx Laboratories Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/dopamine++da+++d+4/pmc11311127-90-21-29
Average 90 stars, based on 1 article reviews
dopamine (da)- d 4 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
human dopamine d1, d2, d4 rat d3 receptors  (BioSignal Group)
90
BioSignal Group human dopamine d1, d2, d4 rat d3 receptors
Silencing <t>DRD4</t> significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).
Human Dopamine D1, D2, D4 Rat D3 Receptors, supplied by BioSignal Group, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/human+dopamine+d1++d2++d4+rat+d3+receptors/us07081470-577-11-17
Average 90 stars, based on 1 article reviews
human dopamine d1, d2, d4 rat d3 receptors - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
dopamine (da)-d4  (Qmx Laboratories Ltd)
90
Qmx Laboratories Ltd dopamine (da)-d4
Silencing <t>DRD4</t> significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).
Dopamine (Da) D4, supplied by Qmx Laboratories Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dopamine+d4/dopamine++da++d4/pm39058922-109-12-17
Average 90 stars, based on 1 article reviews
dopamine (da)-d4 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Silencing DRD4 significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).

Journal: Investigative Ophthalmology & Visual Science

Article Title: Distinct Transcriptomic Profiles of Cultured Anterior and Posterior Populations of Human Infant Scleral Fibroblasts: Including Dopamine Receptors

doi: 10.1167/iovs.66.5.29

Figure Lengend Snippet: Silencing DRD4 significantly enhances DA-mediated contraction inhibition, particularly in posterior scleral fibroblasts. ( a , b ) Seven-day gel contraction curves of DRD2 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA. Each condition was tested in triplicate for cells derived from two donors ( n = 6). The control group was transfected with non-targeting siRNA. ( c , e ) Western blot validation of DRD2 knockdown in anterior and posterior fibroblasts from two donors. ( d , f ) Comparison of contraction rates at day 7 for DRD2 -knockdown anterior and posterior cells, respectively. Statistical analysis: *** P < 0.001, **** P < 0.0001 (two-way ANOVA). ( g , h ) Seven-day gel contraction curves of DRD4 -knockdown anterior and posterior infant scleral fibroblasts, with or without 50-µM DA ( n = 6). ( i , k ) Western blot validation of DRD4 knockdown in anterior and posterior fibroblasts from two donors. ( j , l ) Comparison of contraction rates at day 7 for DRD4 -knockdown anterior and posterior cells, respectively. Statistical analysis: * P < 0.05, ** P < 0.01, **** P < 0.0001 (two-way ANOVA). ( m , o ) Percentage reduction in gel contraction on day 7 resulting from siRNA-knockdown of DRD2 or DRD4 , compared to non-targeting siRNA controls, in anterior and posterior scleral fibroblasts, respectively. Statistical analysis: * P < 0.05, **** P < 0.0001 ( t -test). ( n , p ) Percentage reduction in gel contraction on day 7 caused by DA treatment alone (compared to control), and by DRD2 or DRD4 knockdown combined with DA (compared to DRD2 or DRD4 knockdown without DA), in anterior and posterior fibroblasts, respectively ( n = 6). Whiskers represent minimum to maximum values. * P < 0.05, ** P < 0.01, **** P < 0.0001 (one-way ANOVA).

Article Snippet: The antibodies used were as follows: Dopamine Receptor D1 Rabbit mAb (381747; Zen-Bioscience), DRD2 polyclonal antibody (55084-1-AP; Proteintech, Rosemont, IL, USA), Dopamine Receptor D3 Rabbit mAb (382983; Zen-Bioscience), DRD4 Rabbit polyclonal antibody (28094-1-AP; Proteintech), Dopamine Receptor D5 Rabbit pAb (820522; Zen-Bioscience), GAPDH (7E4) Mouse mAb (200306-7E4; Zen-Bioscience), Beta Tubulin Polyclonal antibody (10094-1-AP; Proteintech), Goat anti-Rabbit IgG(H&L) (HRP conjugate) (511203; Zen-Bioscience), and Goat anti-Mouse IgG (H&L) (HRP conjugate) (511103; Zen-Bioscience).

Techniques: Inhibition, Knockdown, Derivative Assay, Control, Transfection, Western Blot, Biomarker Discovery, Comparison